EDP Sciences logo
Search
Menu
All issues Volume 41 / No 1 (January-February 2010) Apidologie, 41 1 (2010) 96-98 Full HTML
Free Access
Issue
Apidologie
Volume 41, Number 1, January-February 2010
Page(s) 96 - 98
DOI https://doi.org/10.1051/apido/2009060
Published online 16 November 2009

Apis florea (Smith, 1858) and A. andreniformis (Fabricius, 1787) comprise the sole members of a subgenus of honey bee known as Micrapis (Maa, 1953) or dwarf honey bees (Oldroyd and Wongsiri, 2006). The species are superficially similar, but distinguishing characteristics include behaviour, the morphology of the crown of the nest, and body colour (Oldroyd and Wongsiri, 2006). However diagnosis is not always straightforward due to a rare yellow A. andreniformis morph that is very similar to A. florea (Higgs et al., 2009). Nor are the above characteristics diagnostic when only immature lifestages are available.

Here we report what we believe is an unequivocal test of species identity utilizing the mitochondrial large subunit ribosomal RNA gene (rrnL). The test is applicable to all life stages and castes, and will thus be useful for quarantine officials and studies of inter-specific reproductive parasitism.

POLYMERASE CHAIN REACTION PRIMER DESIGN

In March 2008 we retrieved all available A. andreniformis and A. florea mitochondrial sequences in GenBank in order to identify any sequences that showed significant differences between the two species. This search revealed a region of the rrnL, 13 484 − 13 706 bp relative to the A. mellifera mitochondrial genome (Crozier and Crozier, 1993), that contains an 11 base pair (bp) length polymorphism between A. andreniformis (250 bp) and A. florea (239 bp) (GenBank accession numbers A. andreniformis AY588425 (Raffiudin and Crozier, 2007), A. florea L22894 (Cameron, 1993)). From these sequences we designed primers for polymerase chain reaction (PCR) as follows: forward: 5’TGGGACGATAAGACCCTATAGA, reverse: 5’TCGAGGTCGCAATCATCTTT. To enable visualization of PCR product with a genetic analyser a second forward primer was designed with an additional unique 5’ tag sequence: 5’CCTGGCGACTCCTGGAG complementary to an oligo fluorescently labeled with HEX (Genosys). Un-tagged PCR products were analysed by gel electrophoresis.

To verify that the polymorphism is a valid test of species identity we examined single workers from 15 A. florea and 17 A. andreniformis colonies collected from throughout Thailand. An additional 3 A. florea samples were examined from Kanataka, India. The species of each colony had been determined in the field by the colour of the first abdominal segment of the majority of workers and/or the morphology of the nest crown. DNA was extracted from a hind leg of each worker in 5% Chelex solution (Oldroyd et al., 1998).

Amplification from 0.75 μL of extracted DNA was conducted in a total volume of 25 μL containing 4 mM of each dNTP, 2 mM MgCl2, 1 × reaction buffer (BIOLINE), 0.2 units BIOTAQ DNA polymerase (BIOLINE), 0.08 μM tagged forward primer, 0.4 μM reverse primer and 0.8 μM HEX labeled oligo (complementary to the tag sequence, Genosys). A thermal profile of 94 °C for 2 minutes, 30 × (94 °C, 57 °C, 72 °C for 30 seconds each), followed by 72 °C for 10 minutes was used.

thumbnail Figure 1

A fragment of rrnL from A. florea and A. andreniformis workers amplified and run on an EtBr stained, 3.5% agarose gel. Lanes 1, 3 and 5 are A. florea workers and lanes 2, 4 and 6 A. andreniformis workers. All workers originated from different colonies. Edge lanes are 20 bp molecular ladder (EZ Load, BIO-RAD).

GENETIC ANALYSIS

We sized the PCR products with a 3130 xl Genetic Analyser (AppliedBiosystems) before analysing the results with GeneMapper v 3.7. We found all 17 A. andreniformis rrnL fragments to be 250 bps, 15 A. florea to be 245 bps and 3 A. florea , those from India, to be 246 bps in length (lengths exclude the tag sequence). This is consistent with the mitochondrial divergence previously found between Thailand and India in A. florea (Smith, 1991).

As the A. florea PCR products were larger than expected, 5 samples of A.florea (accession number FJ348344), including 1 from India (accession number FJ348345), and A. andreniformis (accession number FJ348343) were sequenced in both directions at a commercial facility (Macrogen, Korea). The resulting sequences confirmed the fragment lengths obtained from the genetic analyser. Eight insertions and 1 (Indian sample) or 2 (Thailand samples) deletions in the sequences obtained explained the 6 bp difference from the published sequence (Cameron, 1993).

GEL ELECTROPHORESIS

PCR products obtained from A. florea and A. andreniformis can be resolved by agarose gel electrophoresis (Fig. 1). We diluted PCR products 1:5 with H2O before running 4 μL with 1 μL of 5 × nucleic acid loading buffer (BIO-RAD) in a 3.5% low range ultra agarose gel (BIO-RAD), 0.5 μg/μL EtBr. Gels were run in 0.5 μg/μL EtBr, 1% TBE buffer for 7 hours at 70 V. Gels were visualised under UV light and products sized via the inclusion of a 20 bp molecular ladder (EZ load, BIO-RAD).

CONCLUSION

Our results demonstrate that the size polymorphism in this fragment of the rrnL gene reliably distinguishes A. andreniformis and A. florea. With some slight modifications to the DNA extraction protocol, we have successfully employed the above method to assign species to adult drones, a queen and drone brood of all stages.

Acknowledgments

We would like to thank past and present members of the Behaviour and Genetics of Social Insects Lab, especially Piyamas Nanork, for providing biological samples.

References

  • Cameron S.A. (1993) Multiple origins of advanced eusociality in bees inferred from mitochondrial DNA sequences, Proc. Natl Acad. Sci. (USA) 90, 8687–8691 [CrossRef] [Google Scholar]
  • Crozier R.H., and Crozier Y.C. (1993) The mitochondrial genome of the honeybee Apis mellifera: Complete sequence and genome organization, Genetics 133, 97–117 [PubMed] [Google Scholar]
  • Fabricius J.C. (1787) Mantissa Insectorium Sistems eorum Species nuper Detectas adiectis Characteribus Genericus, Differentiis Specificis, Emendationibus, Observationibus, C.G. Proft, Copenhagen. [Google Scholar]
  • Higgs J.S., Wattanachaiyingcharoen W., and Oldroyd B.P. (2009) A scientific note on a genetically-determined color morph of the dwarf honey bee, Apis andreniformis, Apidologie 40, 513–514 [CrossRef] [EDP Sciences] [Google Scholar]
  • Maa T. (1953) An inquiry into the systematics of the tribus Apidini or honeybees (Hym.), Treubia 21, 525–640 [Google Scholar]
  • Oldroyd B.P., Wongsiri S. (2006) Introduction to the species, in: Asian honey bees: Biology, conservation, and human interactions, Harvard University Press, Cambridge, pp. 13–35. [Google Scholar]
  • Oldroyd B.P., Clifton M.J., Parker K., Wongsiri S., Rinderer T.E., and Crozier R.H. (1998) Evolution of mating behavior in the genus Apis and an estimate of mating frequency in Apis cerana (Hymenoptera: Apidae), Ann. Entomol. Soc. Am. 91, 700–709 [Google Scholar]
  • Raffiudin R., and Crozier R.H. (2007) Phylogenetic analysis of honey bee behavioral evolution, Mol. Phylogenet. Evol. 43, 543–552 [CrossRef] [PubMed] [Google Scholar]
  • Smith D.R. (1991) Mitochondrial DNA and honey bee biogeography, in: Diversity in the genus Apis, Westview Press, Boulder, pp. 131–176. [Google Scholar]
  • Smith F. (1858) Catalogue of hymenopterous insects collected Sarawak, Borneo; Mount Ophir, Malacca; and at Singapore, in: Wallace A.R. (Ed.), Proc. Linn. Soc. Lond. 2, 42–130. [Google Scholar]

© INRA/DIB-AGIB/EDP Sciences, 2010

All Figures

thumbnail Figure 1

A fragment of rrnL from A. florea and A. andreniformis workers amplified and run on an EtBr stained, 3.5% agarose gel. Lanes 1, 3 and 5 are A. florea workers and lanes 2, 4 and 6 A. andreniformis workers. All workers originated from different colonies. Edge lanes are 20 bp molecular ladder (EZ Load, BIO-RAD).
In the text